Arid3c^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arid3c^em1(IMPC)J
• Name: AT-rich interaction domain 3C; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7428738
• Gene: Arid3c Location: Chr4:41723836-41731142 bp, - strand Genetic Position: Chr4, 22.01 cM
• Alliance: Arid3c^em1(IMPC)J page
• IMPC: Arid3c gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAATTAGTGGTGGACCCAC and GCAAGGTCTGAGCTACCTAG, which resulted in a 517 bp deletion beginning at Chromosome 4 position 41,727,825 bp and ending after 41,728,341 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000527822 (exon 3) and 444 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 103 and early truncation 3 amino acids later. There is a 13 bp insertion (ACTCATTAACCTG) at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Arid3c Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)