Tti1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tti1^em1(IMPC)J
• Name: TELO2 interacting protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7428768
• Synonyms: Tti1^-
• Gene: Tti1 Location: Chr2:157823723-157870353 bp, - strand Genetic Position: Chr2, 78.68 cM
• Alliance: Tti1^em1(IMPC)J page
• IMPC: Tti1 gene page

Tti1^em1(IMPC)J/Tti1^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida and form typical outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGTCAGCTCAAATGCCAAG and GTATAAGAGTTGTCCTGAGG, which resulted in a 4131 bp deletion beginning at Chromosome 2 position 157,996,891 bp and ending after 158,001,021 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001259605 and ENSMUSE00001282578 (exons 3 and 4) and 3793 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 766 and early truncation 36 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tti1 Mutation: 49 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)