Myh15^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Myh15^em1(IMPC)J
• Name: myosin, heavy chain 15; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7431485
• Gene: Myh15 Location: Chr16:48877849-49019467 bp, + strand Genetic Position: Chr16, 30.75 cM
• Alliance: Myh15^em1(IMPC)J page
• IMPC: Myh15 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAGATCAAGAGGCAATACG and GGAGTCTCTTTAAATGACGG, which resulted in a 1220 bp deletion beginning at Chromosome 16 position 49,069,183 bp and ending after 49,070,402 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000902859, ENSMUSE00000880398 (exons 4 and 5) and 1035 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 112 and early truncation 25 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Myh15 Mutation: 84 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)