Diras2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Diras2^em1(IMPC)J
• Name: DIRAS family, GTP-binding RAS-like 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7432284
• Gene: Diras2 Location: Chr13:52658416-52685315 bp, - strand Genetic Position: Chr13, 27.3 cM
• Alliance: Diras2^em1(IMPC)J page
• IMPC: Diras2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAAGTGCGTGGTCATGTGAG and CGGAACAGAGCAACGACTAC, which resulted in a 576 bp deletion beginning at Chromosome 13 position 52,507,673 bp and ending after 52,508,248 bp (GRCm38/mm10). This mutation deletes 576 bp from ENSMUSE00000409549 (exon 2) and is predicted to cause an early termination after amino acid residue 7. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Diras2 Mutation: 20 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)