About   Help   FAQ
Gpr89em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gpr89em1(IMPC)J
Name: G protein-coupled receptor 89; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7434700
Gene: Gpr89  Location: Chr3:96775630-96812662 bp, - strand  Genetic Position: Chr3, 42.01 cM, cytoband F2
Alliance: Gpr89em1(IMPC)J page
IMPC: Gpr89 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGTCACATAAGATTTACA and CCATGGGTCGTATTCAGCAT, which resulted in a 1011 bp deletion beginning at Chromosome 3 position 96,892,679 bp and ending after 96,893,689 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001216982 and ENSMUSE00001294364 (exons 4 and 5) and 802 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 68 and early truncation 44 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gpr89 Mutation:  36 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory