Mir379^em1Rnat
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mir379^em1Rnat
• Name: microRNA 379; endonuclease-mediated mutation 1, Rama Natarajan
• MGI ID: MGI:7435009
• Synonyms: miR-379KO
• Gene: Mir379 Location: Chr12:109675494-109675559 bp, + strand Genetic Position: Chr12, 60.56 cM
• Alliance: Mir379^em1Rnat page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• CRISPR/Cas9 technology generated a 36 bp (ACTATGGAACGTAGGCGTTATGTTTTTGACCTATGT) deletion. (J:333117)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mir379 Mutation: 3 strains or lines available

References

• Original: J:333117 Kato M, et al., miR-379 deletion ameliorates features of diabetic kidney disease by enhancing adaptive mitophagy via FIS1. Commun Biol. 2021 Jan 4;4(1):30
• All: 1 reference(s)