Septin2^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Septin2^em1(IMPC)Tcp
• Name: septin 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7435545
• Gene: Septin2 Location: Chr1:93406238-93437455 bp, + strand Genetic Position: Chr1, 47.24 cM
• Alliance: Septin2^em1(IMPC)Tcp page
• IMPC: Septin2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CTTGTTGATAAGAACGAATA targeting the 5' side and GAACCTCATTGAGTAGGAC targeting the 3' side flanking the critical region to delete exons 5 to 7 ( ENSMUSE00001407774, ENSMUSE00001408284 and ENSMUSE00001412668). This resulted in a 3,394 bp deletion, Chr1:93423975 to 93427368 (GRCm39). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Septin2 Mutation: 57 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)