About   Help   FAQ
Septin2em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Septin2em1(IMPC)Tcp
Name: septin 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:7435545
Gene: Septin2  Location: Chr1:93406238-93437455 bp, + strand  Genetic Position: Chr1, 47.24 cM
Alliance: Septin2em1(IMPC)Tcp page
IMPC: Septin2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CTTGTTGATAAGAACGAATA targeting the 5' side and GAACCTCATTGAGTAGGAC targeting the 3' side flanking the critical region to delete exons 5 to 7 ( ENSMUSE00001407774, ENSMUSE00001408284 and ENSMUSE00001412668). This resulted in a 3,394 bp deletion, Chr1:93423975 to 93427368 (GRCm39). (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Septin2 Mutation:  57 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory