Slc22a7^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc22a7^em1(IMPC)Tcp
• Name: solute carrier family 22 (organic anion transporter), member 7; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7435546
• Gene: Slc22a7 Location: Chr17:46743109-46749383 bp, - strand Genetic Position: Chr17, 22.9 cM, cytoband C
• Alliance: Slc22a7^em1(IMPC)Tcp page
• IMPC: Slc22a7 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGACTCCCCCAGACCTCCGT targeting the 5' side and CAGGCGCCCAGGCGCTCCAA targeting the 3' side of a critical region (ENSMUSE00000542695). This resulted in a 368-bp del chr17:46745722 to 46746089 and a 6-bp deletion (GGAGGT) chr17:46746115 to 46746120_insTC on the minus strand (GRCm39). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Slc22a7 Mutation: 22 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)