Thtpa^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Thtpa^em1(IMPC)Tcp
• Name: thiamine triphosphatase; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7435548
• Gene: Thtpa Location: Chr14:55332241-55336443 bp, + strand Genetic Position: Chr14, 28.07 cM
• Alliance: Thtpa^em1(IMPC)Tcp page
• IMPC: Thtpa gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGCACCAAACAGCGGUACCU targeting the 5' side and GAAUCAAUGGCAUCGACCAA targeting the 3' side of a critical region (ENSMUSG00000045691.15). This resulted in a 2695-bp deletion chr14:55332584 to 55335278 (GRCm39) which deleted the entire open reading frame. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Thtpa Mutation: 11 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)