About   Help   FAQ
Nipsnap3bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Nipsnap3bem1(IMPC)J
Name: nipsnap homolog 3B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7435701
Gene: Nipsnap3b  Location: Chr4:53011932-53022060 bp, + strand  Genetic Position: Chr4, 28.57 cM, cytoband B3
Alliance: Nipsnap3bem1(IMPC)J page
IMPC: Nipsnap3b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGAGTCTCCGAACAAAGAT and CGTCGCTGTTAAGTACACAG, which resulted in a 10,575 bp deletion beginning at Chromosome 4 position 53,011,600 bp and ending after 53,022,174 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000814213, ENSMUSE00001033419, ENSMUSE00000995530, ENSMUSE00000980454, ENSMUSE00000987062, ENSMUSE00000413885 (exons 1-6) and 9023 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to generate a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Nipsnap3b Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory