Ubxn11^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ubxn11^em1(IMPC)J
• Name: UBX domain protein 11; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7437469
• Gene: Ubxn11 Location: Chr4:133829811-133854095 bp, + strand Genetic Position: Chr4, 66.5 cM, cytoband D3
• Alliance: Ubxn11^em1(IMPC)J page
• IMPC: Ubxn11 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCACATGCGGTGCTTACAGC and GGGTTCTATTCAGCCCCACA, which resulted in a 1340 bp deletion beginning at Chromosome 4 position 134,112,348 bp and ending after 134,113,687 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001252036, ENSMUSE00001260575, and ENSMUSE00001254134 (exons 5, 6, and 7) and 1113 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 66 and early truncation 26 amino acids later. There is a single bp (A) insertion at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ubxn11 Mutation: 106 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)