Scn1a^em1Anord
Endonuclease-mediated Allele Detail

Summary

• Symbol: Scn1a^em1Anord
• Name: sodium channel, voltage-gated, type I, alpha; endonuclease-mediated mutation 1, Alexander S Nord
• MGI ID: MGI:7437626
• Synonyms: 1b^-, Scn1a 1b deletion
• Gene: Scn1a Location: Chr2:66101125-66271181 bp, - strand Genetic Position: Chr2, 39.13 cM
• Alliance: Scn1a^em1Anord page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Modified isoform(s), Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: Evolutionary conserved alternative 5' UTR-containing 1st exon 1b and associated promoter (Rr56937) were targeted with sgRNAs (targeting GGAGATCTGGGTAGTCCTCG and GCTTTTCATACTATAGTGAG) using CRISPR/Cas9 technology, resulting in a 3064 bp deletion (chr2:66237911-66240974 (GRCm39)). (J:333350)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Scn1a Mutation: 114 strains or lines available

References

• Original: J:333350 Haigh JL, et al., Deletion of a non-canonical regulatory sequence causes loss of Scn1a expression and epileptic phenotypes in mice. Genome Med. 2021 Apr 26;13(1):69
• All: 1 reference(s)