Mybph^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mybph^em1(IMPC)J
• Name: myosin binding protein H; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7437915
• Gene: Mybph Location: Chr1:134121186-134128970 bp, + strand Genetic Position: Chr1, 58.15 cM
• Alliance: Mybph^em1(IMPC)J page
• IMPC: Mybph gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTGTAGGAACGTCGTAGGT and GGTGGGGAGAGAAGTAGTCG, which resulted in a 1002 bp deletion beginning at Chromosome 1 position 134,124,648 bp and ending after 134,125,649 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000252306, ENSMUSE00000252298 and ENSMUSE00000252292 (exons 4, 5 and 6) and 577 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 175 and early truncation 40 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mybph Mutation: 28 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)