Lrrc28^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lrrc28^em1(IMPC)J
• Name: leucine rich repeat containing 28; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7439819
• Gene: Lrrc28 Location: Chr7:67163158-67295016 bp, - strand Genetic Position: Chr7, 37.05 cM, cytoband C
• Alliance: Lrrc28^em1(IMPC)J page
• IMPC: Lrrc28 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGTGAGAAGAGTGATGAG and CAAACAGAGCTTGTATTAGC, which resulted in a 1450 bp deletion beginning at Chromosome 7 position 67,617,757 bp and ending after 67,619,206 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000200384, ENSMUSE00000200380 (exons 4 and 5) and 1274 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 70 and early truncation 13 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Lrrc28 Mutation: 27 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)