Rr387^em1Zyliu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr387^em1Zyliu
• Name: regulatory region 387; endonuclease-mediated mutation 1, Zhiyong Liu
• MGI ID: MGI:7440065
• Synonyms: E0 KO, Eh1^-
• Gene: Rr387 Location: unknown Genetic Position: Chr6, Syntenic
• Alliance: Rr387^em1Zyliu page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: Atoh1 enhancer Eh1 or E0 was targeted with sgRNAs (targeting AGTGGAAGCTCTGCTCACCG and AGGAGACTGGATCTCCAAGC) using CRISPR/Cas9 technology, resulting in a 2024 bp deletion (chr6:64709990-64712013 (GRCm39)) including the enhancer. (J:332270, J:333396)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr387 Mutation: 0 strains or lines available

References

• Original: J:333396 Luo Z, et al., Three distinct Atoh1 enhancers cooperate for sound receptor hair cell development. Proc Natl Acad Sci U S A. 2022 Aug 9;119(32):e2119850119
• All: 2 reference(s)