Rr388^em1Zyliu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr388^em1Zyliu
• Name: regulatory region 388; endonuclease-mediated mutation 1, Zhiyong Liu
• MGI ID: MGI:7440077
• Synonyms: E3 KO, Eh2^-
• Gene: Rr388 Location: Chr6:64774536-64777054 bp Genetic Position: Chr6, Syntenic
• Alliance: Rr388^em1Zyliu page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: Atoh1 enhancer Eh2 or E3 was targeted with sgRNAs (targeting AGAGGGATCAAAGTATCTAT and GTGCATAGCACTTCCATAGT) using CRISPR/Cas9 technology, resulting in a 3033 bp deletion (chr6:64774177-64777209 (GRCm39)) including the enhancer. This allele was created in cells that already carry the Rr387^em1Zyliu Atoh1 enhancer Eh1 or E0 deletion allele. (J:332270, J:333396)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr388 Mutation: 0 strains or lines available

References

• Original: J:333396 Luo Z, et al., Three distinct Atoh1 enhancers cooperate for sound receptor hair cell development. Proc Natl Acad Sci U S A. 2022 Aug 9;119(32):e2119850119
• All: 2 reference(s)