Rr272^em1Issa
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr272^em1Issa
• Name: regulatory region 272; endonuclease-mediated mutation 1, Issam Aldiri
• MGI ID: MGI:7443202
• Synonyms: VSX2-SE-KO
• Gene: Rr272 Location: unknown Genetic Position: Chr12, Syntenic
• Alliance: Rr272^em1Issa page

Mutation origin

• Strain of Origin: (C57BL/6J x DBA/2J)F1

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutations: Intergenic deletion, Intragenic deletion
• Rr272^em1Issa involves 6 genes/genome features (Rr275, Rr274, Rr276 ...) View all
• Mutation details: The Vsx2 super-enhancer was targeted with sgRNAs (targeting GCAGGCCATGTGCTCGTCGA and CAGGGTGCAGGCTGACAACG) using CRISPR/Cas9 technology, resulting in the deletion of super-enhancer component enhancers Rr274, Rr275 and Rr276 (which contains Rr261800 and Rr268660), but not Rr273, and an alternative exon 1 of Lin52. The deletion is 31721 bp (chr12:84579817-84611537 (GRCm39)). (J:333875)

Expression

In Mice Carrying this Mutation:	1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr272 Mutation: 0 strains or lines available

References

• Original: J:333875 Bian F, et al., Functional analysis of the Vsx2 super-enhancer uncovers distinct cis-regulatory circuits controlling Vsx2 expression during retinogenesis. Development. 2022 Aug 1;149(15):dev200642
• All: 1 reference(s)