About   Help   FAQ
Rr272em1Issa
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr272em1Issa
Name: regulatory region 272; endonuclease-mediated mutation 1, Issam Aldiri
MGI ID: MGI:7443202
Synonyms: VSX2-SE-KO
Gene: Rr272  Location: Chr12:84570408-84611689 bp  Genetic Position: Chr12, Syntenic
Alliance: Rr272em1Issa page
Mutation
origin
Strain of Origin:  (C57BL/6J x DBA/2J)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutations:    Intergenic deletion, Intragenic deletion
  Rr272em1Issa involves 6 genes/genome features (Lin52, Rr274, Rr275 ...) View all
 
Mutation detailsThe Vsx2 super-enhancer was targeted with sgRNAs (targeting GCAGGCCATGTGCTCGTCGA and CAGGGTGCAGGCTGACAACG) using CRISPR/Cas9 technology, resulting in the deletion of super-enhancer component enhancers Rr274, Rr275 and Rr276 (which contains Rr261800 and Rr268660), but not Rr273, and an alternative exon 1 of Lin52. The deletion is 31721 bp (chr12:84579817-84611537 (GRCm39)). (J:333875)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 5 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr272 Mutation:  0 strains or lines available
References
Original:  J:333875 Bian F, et al., Functional analysis of the Vsx2 super-enhancer uncovers distinct cis-regulatory circuits controlling Vsx2 expression during retinogenesis. Development. 2022 Aug 1;149(15):dev200642
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory