Rr273^em1Issa
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr273^em1Issa
• Name: regulatory region 273; endonuclease-mediated mutation 1, Issam Aldiri
• MGI ID: MGI:7443203
• Synonyms: VSX2-EN1-KO
• Gene: Rr273 Location: unknown Genetic Position: Chr12, Syntenic
• Alliance: Rr273^em1Issa page

Mutation origin

• Strain of Origin: (C57BL/6J x DBA/2J)F1

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The Vsx2 enhancer, part of super-enhancer Rr272, was targeted with sgRNAs (targeting GTTAGACCTAGTCAGAACTC and TACTTCAGACTCTGGCTCCA) using CRISPR/Cas9 technology, resulting in a 789 bp deletion (chr12:84578820-84579608 (GRCm39)). (J:333875)

Expression

In Mice Carrying this Mutation:	1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr273 Mutation: 0 strains or lines available

References

• Original: J:333875 Bian F, et al., Functional analysis of the Vsx2 super-enhancer uncovers distinct cis-regulatory circuits controlling Vsx2 expression during retinogenesis. Development. 2022 Aug 1;149(15):dev200642
• All: 1 reference(s)