Rr258107^em1Issa
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr258107^em1Issa
• Name: regulatory region 258107; endonuclease-mediated mutation 1, Issam Aldiri
• MGI ID: MGI:7443204
• Synonyms: VSX2-CTCF-KO
• Gene: Rr258107 Location: Chr12:84636201-84636600 bp, . strand Genetic Position: Chr12, Syntenic
• Alliance: Rr258107^em1Issa page

Mutation origin

• Strain of Origin: (C57BL/6J x DBA/2J)F1

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The Vsx2 CTCF-binding site, located in intron 3, was targeted with sgRNAs (targeting GAGTCTCTAAAAGTAGGAAA and ACCTAATCAAGCAATCAAGT) using CRISPR/Cas9 technology, resulting in a 485 bp deletion (chr12:84636509-84636993 (GRCm39)). (J:333875)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr258107 Mutation: 0 strains or lines available

References

• Original: J:333875 Bian F, et al., Functional analysis of the Vsx2 super-enhancer uncovers distinct cis-regulatory circuits controlling Vsx2 expression during retinogenesis. Development. 2022 Aug 1;149(15):dev200642
• All: 1 reference(s)