Sppl2b^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sppl2b^em1(IMPC)Tcp
• Name: signal peptide peptidase like 2B; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7444921
• Gene: Sppl2b Location: Chr10:80691109-80704542 bp, + strand Genetic Position: Chr10, 39.72 cM
• Alliance: Sppl2b^em1(IMPC)Tcp page
• IMPC: Sppl2b gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CTGCACAGGGGCCACTCTAC targeting the 5' side and AGCCACAGGGTATGACACGG targeting the 3' side of a critical region (ENSMUSE00000305070, ENSMUSE00000305063, ENSMUSE00000304985, and ENSMUSE00000305049). This resulted in a 1,246-bp deletion of Chr10 from 80698362 to 80699607 (GRCm39). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Sppl2b Mutation: 29 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)