Insm2^em1Tcai
Endonuclease-mediated Allele Detail

Summary

• Symbol: Insm2^em1Tcai
• Name: insulinoma-associated 2; endonuclease-mediated mutation 1, Tao Cai
• MGI ID: MGI:7446800
• Gene: Insm2 Location: Chr12:55646212-55648818 bp, + strand Genetic Position: Chr12, 24.05 cM
• Alliance: Insm2^em1Tcai page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology targeting the coding region generated a 25-bp deletion (c.108_132delAGTCCCCGACCGGGCTCCTCCGGTG), resulting in a frameshift mutation p.S36fsX67 and disrupting the reading frame. While mRNA levels are dramatically decreased, Western blot analysis confirmed absence of protein in the brain of homozygotes. (J:334013)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Insm2 Mutation: 23 strains or lines available

References

• Original: J:334013 Wang L, et al., Targeted deletion of Insm2 in mice result in reduced insulin secretion and glucose intolerance. J Transl Med. 2018 Oct 25;16(1):297
• All: 2 reference(s)