Bpifb6^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Bpifb6^em1(IMPC)J
• Name: BPI fold containing family B, member 6; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7447043
• Gene: Bpifb6 Location: Chr2:153742308-153754715 bp, + strand Genetic Position: Chr2, 75.99 cM
• Alliance: Bpifb6^em1(IMPC)J page
• IMPC: Bpifb6 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGTACAATGAGAACTGAG and CACAGCGTGCAAAATTACCA, which resulted in a 1177 bp deletion beginning at Chromosome 2 position 153,903,913 bp and ending after 153,905,089 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000555395, ENSMUSE00000555393, and ENSMUSE00000555390 (exons 5, 6, and 7) and 867 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 66 and early truncation 12 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Bpifb6 Mutation: 27 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)