Nes^em1Pqt
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nes^em1Pqt
• Name: nestin; endonuclease-mediated mutation 1, Paul Q Thomas
• MGI ID: MGI:7447464
• Synonyms: Nes FS
• Gene: Nes Location: Chr3:87878400-87887758 bp, + strand Genetic Position: Chr3, 38.78 cM
• Alliance: Nes^em1Pqt page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exons 1 and 4 were targeted with two sgRNAs (targeting GGAGCTCAATCGACGCCTGG and GCACAGGAGACCCTACTAAA) using CRISPR/Cas9 technology, resulting in an 8 bp deletion in exon 1 (CGCCTGGA chr3:87878561-87878568 (GRCm39)) that creates a reading frame shift and premature stop codon. (J:314040)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nes Mutation: 82 strains or lines available

References

• Original: J:314040 Thomson E, et al., The Nestin neural enhancer is essential for normal levels of endogenous Nestin in neuroprogenitors but is not required for embryo development. PLoS One. 2021;16(11):e0258538
• All: 1 reference(s)