Rr253em5Kmm
Endonuclease-mediated Allele Detail
|
Symbol: |
Rr253em5Kmm |
Name: |
regulatory region 253; endonuclease-mediated mutation 5, Kenneth M Murphy |
MGI ID: |
MGI:7448466 |
Synonyms: |
delta1+3 |
Gene: |
Rr253 Location: Chr2:45169490-45169853 bp Genetic Position: Chr2, Syntenic
|
Alliance: |
Rr253em5Kmm page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: Using zygotes that already carry the Rr253em3Kmm NFIL3C/EBP binding site 1-deletion allele, binding sites 2 and 3 in the Zeb2 enhancer, located ~165 kb upstream, were targeted with sgRNAs (targeting ATTTTGCAACCCCCCAAAAA and CCGGTGACACACACTGCTCA) and an ssODN template (TGGGGGAATGAATCATCAAAATAACCGGTGGAAAACAAGCTAGATCTGAGTTGAGCAGTGTGTGTCACCGGCTGGTGGAATTTTTAGAAAGGCAGCAGTTTGGGCTCATCACTGCGGTTCCTGATTGCACACACCTGTTTGGGGCATGGAGTCGACCTCCCCCCAAAAAGGGGAAACTGAACTCACTGCTCCTCCTGAG) using CRISPR/Cas9 technology, resulting in an allele lacking binding sites 1 and 3.
(J:334296)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Rr253 Mutation: |
2 strains or lines available
|
|
Original: |
J:334296 Liu TT, et al., Ablation of cDC2 development by triple mutations within the Zeb2 enhancer. Nature. 2022 Jul;607(7917):142-148 |
All: |
1 reference(s) |
|