Rr253^em6Kmm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr253^em6Kmm
• Name: regulatory region 253; endonuclease-mediated mutation 6, Kenneth M Murphy
• MGI ID: MGI:7448467
• Synonyms: delta1+2+3
• Gene: Rr253 Location: unknown Genetic Position: Chr2, Syntenic
• Alliance: Rr253^em6Kmm page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: Using zygotes that already carry the Rr253^em4Kmm NFIL3C/EBP binding site 1&2-deletion allele, binding site 3 in the Zeb2 enhancer, located ~165 kb upstream, were targeted with an sgRNA (targeting CCACCAGCCGGTGACACACA) and an ssODN template (GCTGAAGTTCACCTCCCCATGGGGGAATGAATCATCAAAATAACCGGTGGAAAACAAGCTAGATCTGACTTGAGCAGTGTGTGTCACCGGCTGGTGGAATTTTTAGAAAGGCAGCAGTTTGGGCTCATCACTGCGGTT) using CRISPR/Cas9 technology, resulting in an allele lacking binding sites 1, 2 and 3. (J:334296)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rr253 Mutation: 2 strains or lines available

References

• Original: J:334296 Liu TT, et al., Ablation of cDC2 development by triple mutations within the Zeb2 enhancer. Nature. 2022 Jul;607(7917):142-148
• All: 2 reference(s)