Rr364729^em1Almk
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr364729^em1Almk
• Name: regulatory region 364729; endonuclease-mediated mutation 1, Alasdair MacKenzie
• MGI ID: MGI:7448757
• Synonyms: mGAL5.1KO
• Gene: Rr364729 Location: Chr19:3490401-3491799 bp, . strand Genetic Position: Chr19, Syntenic
• Alliance: Rr364729^em1Almk page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: The Gal enhancer was targeted with sgRNAs (targeting CTCCCTGGAGCAATATGAAG and CCCGCTTTCATGGCTCCCAA) using CRISPR/Cas9 technology, resulting in a 257 bp deletion (chr19:3490919-3491175 (GRCm39)). The orthologous human enhancer is implied in male anxiety and ethanol intake. (J:334339)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr364729 Mutation: 0 strains or lines available

References

• Original: J:334339 McEwan AR, et al., CRISPR disruption and UK Biobank analysis of a highly conserved polymorphic enhancer suggests a role in male anxiety and ethanol intake. Mol Psychiatry. 2021 Jun;26(6):2263-2276
• All: 2 reference(s)