Nubpl^em1Vkim
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nubpl^em1Vkim
• Name: nucleotide binding protein-like; endonuclease-mediated mutation 1, Virginia Kimonis
• MGI ID: MGI:7449244
• Synonyms: Nubpl^L104P
• Gene: Nubpl Location: Chr12:52144529-52357753 bp, + strand Genetic Position: Chr12, 22.11 cM, cytoband C1
• Alliance: Nubpl^em1Vkim page

Mutation origin

• Strain of Origin: C57BL/6NJ

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Nucleotide substitutions
• Mutation details: Leucine codon 104 (TTA) in exon 4 was changed to proline (CCA) (p.L104P) using gRNAs (targeting GGCGGTTGGCTTGTTAGATGTGG and CCAAGGCGGTTGGCTTGTTAGAT) and an ssODN template (AACCTGATGAATAATCTTTTGATGATTTTGGTTTTCTTGCAGTCTAAAGCCGTTGGCTTGCCAGACGTCGAcGTGTATGGTCCTTCCATTCCAAAGATGATGAACCTGAGAGGAAATCCA) with CRISPR/Cas9 technology. The orthologous human mutation is associated with mitochondrial complex I deficiency disorder. (J:333699)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nubpl Mutation: 19 strains or lines available

References

• Original: J:333699 Cheng C, et al., Early embryonic lethality in complex I associated p.L104P Nubpl mutant mice. Orphanet J Rare Dis. 2022 Oct 24;17(1):386
• All: 1 reference(s)