About   Help   FAQ
Srfbp1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Srfbp1em1(IMPC)J
Name: serum response factor binding protein 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7450824
Synonyms: Srfbp1-
Gene: Srfbp1  Location: Chr18:52598765-52625003 bp, + strand  Genetic Position: Chr18, 28.21 cM, cytoband D1
Alliance: Srfbp1em1(IMPC)J page
IMPC: Srfbp1 gene page
Srfbp1em1(IMPC)J/Srfbp1em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as compacting morulae but not at E7.5. Embryos fail to hatch from the zona pellucida and die after 3 days in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAATACCTTTACTGTGGCA and GCTTAATTTTTTAGACTGTG, which resulted in a 4206 bp deletion beginning at Chromosome 18 position 52,483,514 bp and ending after 52,487,719 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000143087 and ENSMUSE00000143081 (exons 4 and 5) and 4052 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 76 and early truncation 191 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Srfbp1 Mutation:  35 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory