Srfbp1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Srfbp1^em1(IMPC)J
• Name: serum response factor binding protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7450824
• Synonyms: Srfbp1^-
• Gene: Srfbp1 Location: Chr18:52598765-52625003 bp, + strand Genetic Position: Chr18, 28.21 cM, cytoband D1
• Alliance: Srfbp1^em1(IMPC)J page
• IMPC: Srfbp1 gene page

Srfbp1^em1(IMPC)J/Srfbp1^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as compacting morulae but not at E7.5. Embryos fail to hatch from the zona pellucida and die after 3 days in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAATACCTTTACTGTGGCA and GCTTAATTTTTTAGACTGTG, which resulted in a 4206 bp deletion beginning at Chromosome 18 position 52,483,514 bp and ending after 52,487,719 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000143087 and ENSMUSE00000143081 (exons 4 and 5) and 4052 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 76 and early truncation 191 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Srfbp1 Mutation: 35 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)