Tsr1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tsr1^em1(IMPC)J
• Name: TSR1 20S rRNA accumulation; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7461809
• Gene: Tsr1 Location: Chr11:74788906-74800166 bp, + strand Genetic Position: Chr11, 45.76 cM
• Alliance: Tsr1^em1(IMPC)J page
• IMPC: Tsr1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATACAGGTGCTGTAACCCCA and CTGCTGGTGTGGGCTATACT, which resulted in a 651 bp deletion beginning at Chromosome 11 position 74,899,096 bp and ending after 74,899,746 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001258182 and ENSMUSE00001246763 (exons 3 and 4) and 296 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 1 amino acid later. There is a 7 bp insertion (TATACTT) 16 bp before the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tsr1 Mutation: 37 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)