About   Help   FAQ
Krt17em1Cou
Endonuclease-mediated Allele Detail
Summary
Symbol: Krt17em1Cou
Name: keratin 17; endonuclease-mediated mutation 1, Pierre A Coulombe
MGI ID: MGI:7464110
Synonyms: Krt17deltaNLS
Gene: Krt17  Location: Chr11:100147043-100151855 bp, - strand  Genetic Position: Chr11, 63.44 cM
Alliance: Krt17em1Cou page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Hypomorph)
Mutation:    Intragenic deletion
 
Mutation detailsThe nuclear localization signal sequence was targeted with an sgRNA (targeting GTACAAGCCAAAAGAACGTAAGG) and an ssODN template (GCATTAGGGGTGAGGAAGGTACTCTCGGATTTCATCTAATCTCTCCAACTTTTTTTTTCCAGCCTGACTCAGTACGCGCCAGCAGAACGTAAGGATATTGGTAACTGAGGGCTGGGGTAGAAGGATGCATGTGGCAGGAATCGCCTAGCAGATTGCTAGG) using CRISPR/Cas9 technology, resulting in lysine codon 399 (AAG) to alanine (GCG) (K399A) and lysine codon 401 (AAA) to alanine (GCA) (K401A) mutations. These mutations destroy the NLS. (J:331728)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Krt17 Mutation:  29 strains or lines available
References
Original:  J:331728 Jacob JT, et al., Keratin 17 regulates nuclear morphology and chromatin organization. J Cell Sci. 2020 Oct 30;133(20):jcs254094
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory