Krt17^em1Cou
Endonuclease-mediated Allele Detail

Summary

• Symbol: Krt17^em1Cou
• Name: keratin 17; endonuclease-mediated mutation 1, Pierre A Coulombe
• MGI ID: MGI:7464110
• Synonyms: Krt17^deltaNLS
• Gene: Krt17 Location: Chr11:100147043-100151855 bp, - strand Genetic Position: Chr11, 63.44 cM
• Alliance: Krt17^em1Cou page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Hypomorph)
• Mutation: Intragenic deletion
• Mutation details: The nuclear localization signal sequence was targeted with an sgRNA (targeting GTACAAGCCAAAAGAACGTAAGG) and an ssODN template (GCATTAGGGGTGAGGAAGGTACTCTCGGATTTCATCTAATCTCTCCAACTTTTTTTTTCCAGCCTGACTCAGTACGCGCCAGCAGAACGTAAGGATATTGGTAACTGAGGGCTGGGGTAGAAGGATGCATGTGGCAGGAATCGCCTAGCAGATTGCTAGG) using CRISPR/Cas9 technology, resulting in lysine codon 399 (AAG) to alanine (GCG) (K399A) and lysine codon 401 (AAA) to alanine (GCA) (K401A) mutations. These mutations destroy the NLS. (J:331728)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Krt17 Mutation: 28 strains or lines available

References

• Original: J:331728 Jacob JT, et al., Keratin 17 regulates nuclear morphology and chromatin organization. J Cell Sci. 2020 Oct 30;133(20):jcs254094
• All: 2 reference(s)