Klrg1^em1Lbro
Endonuclease-mediated Allele Detail

Summary

• Symbol: Klrg1^em1Lbro
• Name: killer cell lectin-like receptor subfamily G, member 1; endonuclease-mediated mutation 1, Laurent Brossay
• MGI ID: MGI:7464198
• Synonyms: KLRG1^-
• Gene: Klrg1 Location: Chr6:122247555-122259792 bp, - strand Genetic Position: Chr6, 57.52 cM
• Alliance: Klrg1^em1Lbro page

Mutation origin

• Strain of Origin: C57BL/6NJ

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Two guide RNAs (ATTGTGGACCATTCAGCTTG and CTTAACTATGTAGTCCAGAC) are designed to target exon 3. Non-homologus endjoining results in the deletion of the sequence between the gRNAs. Klrg1 transcript Klrg1-201 (ENSMUST00000032207.9) was used as reference for exon number and the guide sequences. (J:334818)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Klrg1 Mutation: 23 strains or lines available

References

• Original: J:334818 Tata A, et al., Combination blockade of KLRG1 and PD-1 promotes immune control of local and disseminated cancers. Oncoimmunology. 2021 Jun 15;10(1):1933808
• All: 2 reference(s)