About   Help   FAQ
Got2em1Pcamp
Endonuclease-mediated Allele Detail
Summary
Symbol: Got2em1Pcamp
Name: glutamatic-oxaloacetic transaminase 2, mitochondrial; endonuclease-mediated mutation 1, Philippe Campeau
MGI ID: MGI:7464269
Synonyms: Got2emhD335fs14*
Gene: Got2  Location: Chr8:96590761-96615029 bp, - strand  Genetic Position: Chr8, 47.79 cM
Alliance: Got2em1Pcamp page
Mutation
origin
Strain of Origin:  either: C57BL/6J or (C57BL/6 x C3H)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Not Specified
 
Mutation detailsExon 8 was targeted with an sgRNA (targeting TCCTGACTTCTCCAGACTTG) and an ssODN template (CCGTCCCCTGTATTCCAACCCACCTCTCAATGGGGCCCGGATCGCAGCAACCATTCTGACGTCTCCGGATTTAGGTAAGCAATGGTAACGATTACTAGCTGTTCCGTGCTACAGCTCCATGAATGGAAAAG) using CRISPR/Cas9 technology with the aim to create a p.R337G mutation. The actual result was an unintended insertion/duplication of a single T (A on forward strand, after chr8:96596111 (GRCm39)), which results in a frameshift and premature stop codon. (J:291216)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Got2 Mutation:  26 strains or lines available
References
Original:  J:291216 van Karnebeek CDM, et al., Bi-allelic GOT2 Mutations Cause a Treatable Malate-Aspartate Shuttle-Related Encephalopathy. Am J Hum Genet. 2019 Sep 5;105(3):534-548
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory