Got2^em2Pcamp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Got2^em2Pcamp
• Name: glutamatic-oxaloacetic transaminase 2, mitochondrial; endonuclease-mediated mutation 2, Philippe Campeau
• MGI ID: MGI:7464270
• Synonyms: Got2^emhR337G
• Gene: Got2 Location: Chr8:96590761-96615029 bp, - strand Genetic Position: Chr8, 47.79 cM
• Alliance: Got2^em2Pcamp page

Mutation origin

• Strain of Origin: either: C57BL/6J or (C57BL/6J x C3H/HeJ)F1

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Nucleotide substitutions
• Mutation details: Exon 8 was targeted with an sgRNA (targeting TCCTGACTTCTCCAGACTTG) and an ssODN template (CCGTCCCCTGTATTCCAACCCACCTCTCAATGGGGCCCGGATCGCAGCAACCATTCTGACGTCTCCGGATTTAGGTAAGCAATGGTAACGATTACTAGCTGTTCCGTGCTACAGCTCCATGAATGGAAAAG) using CRISPR/Cas9 technology to change arginine codon 337 (CGG) to glycine (GGT) (p.R337G, c.1009_1011CGG>GGT). The equivalent human mutation (p.Arg337Gly c.1009C>G) is found in some Malate-Aspartate Shuttle (MAS)-Related Encephalopathy patients. (J:291216)

Disease models

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Got2 Mutation: 26 strains or lines available

References

• Original: J:291216 van Karnebeek CDM, et al., Bi-allelic GOT2 Mutations Cause a Treatable Malate-Aspartate Shuttle-Related Encephalopathy. Am J Hum Genet. 2019 Sep 5;105(3):534-548
• All: 1 reference(s)