About   Help   FAQ
Ncf1em1Nansh
Endonuclease-mediated Allele Detail
Summary
Symbol: Ncf1em1Nansh
Name: neutrophil cytosolic factor 1; endonuclease-mediated mutation 1, Nan Shen
MGI ID: MGI:7464912
Synonyms: NCF1 p.R90H
Gene: Ncf1  Location: Chr5:134248907-134258479 bp, - strand  Genetic Position: Chr5, 74.47 cM
Alliance: Ncf1em1Nansh page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsArginine codon 90 (CGC) in exon 4 was changed to histidine (CAC) (p.R90H) using an sgRNA (targeting ACGAGCCGCTGAGAGTCGCC) and an ssODN template (CATGGGTCTCTGGCTCCCCCACCCAGCACCCAGGTGGTTTGATGGGCAACGAGCAGCTGAGTCCCACCAGGGCACTCTCACTGAATACTTCAACGGCCTCATGGGACTGCCCGTGAAGAT) with CRISPR/Cas9 technology. The mutation (SNP rs201802880) is found in some systemic lupus erythematosus (SLE) patients. (J:329553)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ncf1 Mutation:  38 strains or lines available
References
Original:  J:329553 Meng Y, et al., The NCF1 variant p.R90H aggravates autoimmunity by facilitating the activation of plasmacytoid dendritic cells. J Clin Invest. 2022 Aug 15;132(16):e153619
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory