Ncf1^em1Nansh
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ncf1^em1Nansh
• Name: neutrophil cytosolic factor 1; endonuclease-mediated mutation 1, Nan Shen
• MGI ID: MGI:7464912
• Synonyms: NCF1 p.R90H
• Gene: Ncf1 Location: Chr5:134248907-134258479 bp, - strand Genetic Position: Chr5, 74.47 cM
• Alliance: Ncf1^em1Nansh page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Arginine codon 90 (CGC) in exon 4 was changed to histidine (CAC) (p.R90H) using an sgRNA (targeting ACGAGCCGCTGAGAGTCGCC) and an ssODN template (CATGGGTCTCTGGCTCCCCCACCCAGCACCCAGGTGGTTTGATGGGCAACGAGCAGCTGAGTCCCACCAGGGCACTCTCACTGAATACTTCAACGGCCTCATGGGACTGCCCGTGAAGAT) with CRISPR/Cas9 technology. The mutation (SNP rs201802880) is found in some systemic lupus erythematosus (SLE) patients. (J:329553)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ncf1 Mutation: 38 strains or lines available

References

• Original: J:329553 Meng Y, et al., The NCF1 variant p.R90H aggravates autoimmunity by facilitating the activation of plasmacytoid dendritic cells. J Clin Invest. 2022 Aug 15;132(16):e153619
• All: 1 reference(s)