Lgals3^em1Vari
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lgals3^em1Vari
• Name: lectin, galactose binding, soluble 3; endonuclease-mediated mutation 1, van Andel Research Institute
• MGI ID: MGI:7464949
• Synonyms: Lgals3-R200S^KI, Lgals3^tm1Vari
• Gene: Lgals3 Location: Chr14:47611317-47623624 bp, + strand Genetic Position: Chr14, 24.6 cM, cytoband C1
• Alliance: Lgals3^em1Vari page

Mutation origin

• Strain of Origin: (C57BL/6J x C3H/HeJ)F1

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Nucleotide substitutions
• Mutation details: Arginine codon 200 (AGA) in exon 5 was changed to serine (TCA) (p.R200S) using two sgRNAs (targeting CACCTTTGCCACTCTCAAAGGGGA and AAACTCCCCTTTGAGAGTGGCAAA) and an ssODN template with CRISPR/Cas9 technology. The mutation disrupts Lgals3 glycan-binding. (J:329549)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Lgals3 Mutation: 29 strains or lines available

References

• Original: J:329549 Maupin KA, et al., Mutation of the galectin-3 glycan-binding domain (Lgals3-R200S) enhances cortical bone expansion in male mice and trabecular bone mass in female mice. FEBS Open Bio. 2022 Oct;12(10):1717-1728
• All: 1 reference(s)