C2cd5^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: C2cd5^em1(IMPC)Tcp
• Name: C2 calcium-dependent domain containing 5; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7464991
• Gene: C2cd5 Location: Chr6:142956646-143045867 bp, - strand Genetic Position: Chr6, 75.13 cM, cytoband G2
• Alliance: C2cd5^em1(IMPC)Tcp page
• IMPC: C2cd5 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATGCTGATGATGACTACTCG targeting the 5' side and ACTGCAGGTCGCCCTGTAGA targeting the 3' side of a critical region (ENSMUSE00000361445 and ENSMUSE00000374448). This resulted in a 3,009-bp deletion of Chr6 from 143023707 to 143026715 (GRCm39). (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any C2cd5 Mutation: 69 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)