Elp4^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Elp4^em1(IMPC)Tcp
• Name: elongator acetyltransferase complex subunit 4; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7464998
• Gene: Elp4 Location: Chr2:105531372-105734909 bp, - strand Genetic Position: Chr2, 55.33 cM
• Alliance: Elp4^em1(IMPC)Tcp page
• IMPC: Elp4 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CACACCCACCGACTCGTTCA targeting the 5' side and CTGCATTCAGTAGCTTAGTG targeting the 3' side of a critical region (ENSMUSE00000224292). This resulted in a 1849-bp deletion of Chr2 from 105661891 to 105663739 (GRCm39) introducing a frameshift and premature stop codon. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Elp4 Mutation: 29 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)