Reep3^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Reep3^em1(IMPC)Tcp
• Name: receptor accessory protein 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7465002
• Gene: Reep3 Location: Chr10:66844968-66932724 bp, - strand Genetic Position: Chr10, 34.83 cM
• Alliance: Reep3^em1(IMPC)Tcp page
• IMPC: Reep3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGCACCTATACTGACTCCGG targeting the 5' side and GTCATAATCACTAAGAGGTT targeting the 3' side of a critical region (ENSMUSE00000367558 and ENSMUSE00000575837). This resulted in a 1,710-bp deletion of Chr10 from 66870185 to 66871894 (GRCm39). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Reep3 Mutation: 151 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)