Trappc8^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trappc8^em1(IMPC)Tcp
• Name: trafficking protein particle complex 8; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7465004
• Gene: Trappc8 Location: Chr18:20950280-21029150 bp, - strand Genetic Position: Chr18, 11.53 cM
• Alliance: Trappc8^em1(IMPC)Tcp page
• IMPC: Trappc8 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CCGGCTCAAAATGTCTAGAT targeting the 5' side and CAGGTGTGAACTAGTACCAT targeting the 3' side of a critical region from exon 3 to exon 8 (ENSMUSE00000379803, ENSMUSE00000277191, ENSMUSE00000277177, ENSMUSE00000344646, ENSMUSE00000409531, and ENSMUSE00000277110). This resulted in a 10,577-bp deletion of Chr18 from 20997797 to 21008373 (GRCm39) introducing a frameshift and premature stop codon. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Trappc8 Mutation: 66 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)