Ctnna1^em1Xjz
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ctnna1^em1Xjz
• Name: catenin alpha 1; endonuclease-mediated mutation 1, Xianjun Zhu
• MGI ID: MGI:7466923
• Synonyms: Ctnna1^F72S
• Gene: Ctnna1 Location: Chr18:35251955-35387829 bp, + strand Genetic Position: Chr18, 18.89 cM
• Alliance: Ctnna1^em1Xjz page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Phenylalanine codon 72 (TTC) in exon 3 was changed to serine (TCC) (p.F72S) using an sgRNA (targeting AAGCAACTGAGAATTTCTTGG) and an ssODN template (CCATGTTTTGGCTGCATCTGTTGAACAAGCAACTGAGAATTCCTTGGAAAAGGGGGATAAAATTGCAAAAGAGAGCCAGT) with CRIPSR/Cas9 technology. The equivalent human mutation is found in some familial exudative vitreoretinopathy (FEVR) patients. (J:328283)
• Inheritance: Dominant

Disease models

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ctnna1 Mutation: 133 strains or lines available

References

• Original: J:328283 Zhu X, et al., Catenin alpha 1 mutations cause familial exudative vitreoretinopathy by overactivating Norrin/beta-catenin signaling. J Clin Invest. 2021 Mar 15;131(6)
• All: 1 reference(s)