Lrp5^em1Xjz
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lrp5^em1Xjz
• Name: low density lipoprotein receptor-related protein 5; endonuclease-mediated mutation 1, Xianjun Zhu
• MGI ID: MGI:7466960
• Synonyms: Lrp5^P847L
• Gene: Lrp5 Location: Chr19:3634828-3736564 bp, - strand Genetic Position: Chr19, 3.33 cM, cytoband B
• Alliance: Lrp5^em1Xjz page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Proline codon 847 (CCG) in exon 12 was changed to leucine (CTG) (p.P847L) using an sgRNA (targeting GACGATCTGCCCTACCCGTTTGG) and an ssODN template (TATGTGCTATGTCCCCGCACAGGTCAGGAGCGCATGGTGATAGCTGACGATCTGCCCTACCTGTTTGGCCTGACTCAATATAGCGATTACATCTACTGGACTGACTGGAACCTGCATAGCATT) with CRIPSR/Cas9 technology. The equivalent human mutation (p.P848L) is found in some familial exudative vitreoretinopathy (FEVR) patients. (J:328283)

Disease models

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Lrp5 Mutation: 82 strains or lines available

References

• Original: J:328283 Zhu X, et al., Catenin alpha 1 mutations cause familial exudative vitreoretinopathy by overactivating Norrin/beta-catenin signaling. J Clin Invest. 2021 Mar 15;131(6)
• All: 1 reference(s)