About   Help   FAQ
Zfp524em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp524em1(IMPC)J
Name: zinc finger protein 524; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7466984
Gene: Zfp524  Location: Chr7:5018142-5021487 bp, + strand  Genetic Position: Chr7, 2.9 cM, cytoband A1
Alliance: Zfp524em1(IMPC)J page
IMPC: Zfp524 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAGATACTGGGGTACACGG and CTAGGGAGATGTGTGAGATG, which resulted in a 1202 bp deletion beginning at Chromosome 7 position 5,017,385 bp and ending after 5,018,586 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000538365 (exon 2) and 151 bp of flanking intronic sequence including the splice acceptor start site and splice donor and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp524 Mutation:  32 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/05/2024
MGI 6.24
The Jackson Laboratory