Lrfn5^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lrfn5^em1(IMPC)Tcp
• Name: leucine rich repeat and fibronectin type III domain containing 5; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7467316
• Gene: Lrfn5 Location: Chr12:61569936-61905128 bp, + strand Genetic Position: Chr12, 26.43 cM
• Alliance: Lrfn5^em1(IMPC)Tcp page
• IMPC: Lrfn5 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes / injecting Cas9 mRNA with single guide RNAs with spacer sequences AAGAACTGTGGAGCTACGGC and GTATTGCTTCCAATCCGGCA targeting within exon ENSMUSE00000614088. This resulted in a 919bp deletion of Chr12 from 61886383 to 61887301 (GRCm39) introducing a frameshift and premature stop codon. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Lrfn5 Mutation: 40 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)