Ccdc198^em1Iad
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc198^em1Iad
• Name: coiled-coil domain containing 198; endonuclease-mediated mutation 1, Igor Adameyko
• MGI ID: MGI:7481232
• Synonyms: FAME, Fame KO
• Gene: Ccdc198 Location: Chr14:49463815-49482902 bp, - strand Genetic Position: Chr14, 25.46 cM, cytoband C1
• Alliance: Ccdc198^em1Iad page

Mutation origin

• Strain of Origin: FVB.129P2-Pde6b⁺ Tyr^c-ch/AntJ

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: CRISPR/cas9 endonuclease-mediated genome editing is used to insert a double stop codon (TGATGA) downstream of the initator ATG in in exon 2. The sgRNA (GGAACACAGGGCCAGTTGA(GGG), and ssODN donor (CAGTCTCGTGAATGAGCTTTCTTCTTCCAGGTTCCGATTCAATGCAAAGAACACAGGGCCTCACTAGGGTGTCT CTGTTTCTTGGCTTTGTAAAGGTG) were used. (J:337480)

Expression

In Mice Carrying this Mutation:	1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ccdc198 Mutation: 16 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 2 reference(s)