Scaf8^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Scaf8^em1(IMPC)J
• Name: SR-related CTD-associated factor 8; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7481978
• Gene: Scaf8 Location: Chr17:3165247-3249134 bp, + strand Genetic Position: Chr17, 1.96 cM
• Alliance: Scaf8^em1(IMPC)J page
• IMPC: Scaf8 gene page

Mutation origin

• Strain of Origin: Not Applicable
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGAGACTAAAATAGTTCAG and GTTCACACGCTATAGGGCAG, which resulted in a 457 bp deletion beginning at Chromosome 17 position 3,162,731 bp and ending after 3,163,187 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000345755 (exon 5) and 303 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 107 and early truncation 3 amino acids later. There is a 4 bp insertion (CTTC) at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Scaf8 Mutation: 108 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)