Skic8^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Skic8^em1(IMPC)Tcp
• Name: SKI8 subunit of superkiller complex; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7482622
• Gene: Skic8 Location: Chr9:54624437-54641833 bp, - strand Genetic Position: Chr9, 29.73 cM, cytoband C
• Alliance: Skic8^em1(IMPC)Tcp page
• IMPC: Skic8 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATGGGTGCGTTGAGATGATA targeting the 5' side and GCATAACTCCTCATCCTATG targeting the 3' side of a critical region (ENSMUSE00001147183). This resulted in a 147bp deletion of Chr9 from 54631312 to 54631458 (GRCm39), introducing a frameshift and premature stop codon. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Skic8 Mutation: 9 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)