Ugt2b38^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ugt2b38^em1(IMPC)Tcp
• Name: UDP glucuronosyltransferase 2 family, polypeptide B38; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7482623
• Gene: Ugt2b38 Location: Chr5:87557801-87572062 bp, - strand Genetic Position: Chr5, 43.56 cM
• Alliance: Ugt2b38^em1(IMPC)Tcp page
• IMPC: Ugt2b38 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AATTCTGGTCAGGGTACTCA targeting the 5' side and CTATAGGCTGGCCCATTGTC targeting the 3' side of a critical region (ENSMUSE0000105763 and ENSMUSE00001085011). This resulted in a 3841bp deletion of Chr5 from 87566792 to 87570632 with the insertion of aaaaaagaaagaaaaagaa (GRCm39), introducing a frameshift and premature stop codon. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ugt2b38 Mutation: 44 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)