Jade2^em1Cya
Endonuclease-mediated Allele Detail

Summary

• Symbol: Jade2^em1Cya
• Name: jade family PHD finger 2; endonuclease-mediated mutation 1, Cyagen Biosciences
• MGI ID: MGI:7482646
• Gene: Jade2 Location: Chr11:51704282-51748480 bp, - strand Genetic Position: Chr11, 31.5 cM
• Alliance: Jade2^em1Cya page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using sgRNAs TATACGTAGGGTTGTGCCTCTGG and ATCGAGTCCCGTCAATTACACGG deleted exons 4 and 5. Western blot analysis confirmed absence of protein in the hippocampus. (J:333965)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Jade2 Mutation: 33 strains or lines available

References

• Original: J:333965 Fan M, et al., JADE2 Is Essential for Hippocampal Synaptic Plasticity and Cognitive Functions in Mice. Biol Psychiatry. 2022 Nov 15;92(10):800-814
• All: 1 reference(s)