Zfp605^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp605^em1(IMPC)J
• Name: zinc finger protein 605; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7486743
• Gene: Zfp605 Location: Chr5:110257958-110277660 bp, + strand Genetic Position: Chr5, 53.3 cM
• Alliance: Zfp605^em1(IMPC)J page
• IMPC: Zfp605 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATATATCATTAAGCAAAAC and TTAAGGCAGGACAGTCCATC, which resulted in a 18,020 bp deletion beginning at Chromosome 5 position 110,111,841 bp and ending after 110,129,860 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001309111, ENSMUSE00001300810, ENSMUSE00001293032, ENSMUSE00000692012 (exons 2, 3 ,4 and 5) and 15,088 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp605 Mutation: 40 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)