St6galnac1^em1Len
Endonuclease-mediated Allele Detail

Summary

• Symbol: St6galnac1^em1Len
• Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1; endonuclease-mediated mutation 1, Michael J Lenardo
• MGI ID: MGI:7488215
• Synonyms: St6galnac1^R319Q
• Gene: St6galnac1 Location: Chr11:116655851-116666333 bp, - strand Genetic Position: Chr11, 81.49 cM, cytoband E2
• Alliance: St6galnac1^em1Len page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Arginine codon 319 (CGA) was changed to glutamine (CAA) (p.R319Q) using an sgRNA (targeting CCGGTATGTTCTCCCTCCGTTGC) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of a human mutation associated with inflammatory bowel disease (IBD). (J:324883)

Disease models

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any St6galnac1 Mutation: 31 strains or lines available

References

• Original: J:324883 Yao Y, et al., Mucus sialylation determines intestinal host-commensal homeostasis. Cell. 2022 Mar 31;185(7):1172-1188.e28
• All: 1 reference(s)